Gene errors

Sometimes mistakes can happen in the copying of the code when a cell divides. Genetic mistakes can include gene copy errors (gene mutations) or chromosome copy errors (e.g chromosome loss or gain), or structural (rearrangement) abnormalities.

Gene deletion

A section of the DNA can be missed out

GTCAACTGATCGATCGGATCGA
GTCAAC___TCGATCGGATCGA

Gene mutation

The wrong base might be copied

GTCAACTGATCGATCGGATCGA
GTCAACTGCTCGATCGGATCGA

Once these errors are made, the gene may be faulty and not function properly. It may cause a genetic disease, such as cystic fibrosis. The faulty gene will be copied exactly and can be passed down from generation to generation.